sgrna sequences Search Results


90
GenScript corporation sgrna sequence
Sgrna Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+sequences/pmc11078746-219-13-16?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
sgrna sequence - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation the sgrna scaffold sequence
Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the <t>sgRNA</t> <t>scaffold.</t> (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.
The Sgrna Scaffold Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+sequences/pmc09048117-249-5-14?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
the sgrna scaffold sequence - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Promega pcr products containing the sgrna sequences
Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the <t>sgRNA</t> <t>scaffold.</t> (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.
Pcr Products Containing The Sgrna Sequences, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+sequences/pmc12043911-354-2-10?v=Promega
Average 90 stars, based on 1 article reviews
pcr products containing the sgrna sequences - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Microsynth ag sgrna sequences
Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the <t>sgRNA</t> <t>scaffold.</t> (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.
Sgrna Sequences, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+sequences/pm36571986-60-0-5?v=Microsynth+ag
Average 90 stars, based on 1 article reviews
sgrna sequences - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma sgrna sequences fbxw7β
a Transfection efficiency of HN6 and CAL27 NOTCH1 C1133Y and WT cells determined by real-time qPCR. b Growth curves of NOTCH1 WT -transfected cells (blue lines), NOTCH1 C1133Y -transfected cells (red lines) and control cells (black lines). The NOTCH1 C1133Y -transfected cells had higher proliferation rates compared with the NOTCH1 WT -transfected cells. c Colony formation assays were performed for 2 week in six-well cell culture cluster in HN6 and CAL27 stable transfected cells. d NOTCH1 C1133Y - transfected cells presented a significantly lower percentage of G1 phase and higher ratio of S phase than NOTCH1 WT cells. e , f Wound healing and Transwell assays were employed to analyze the cell migration and invasion ability. NOTCH1 C1133Y -transfected cells exhibited higher metastatic ability in HN6 and CAL27 cell lines compared with NOTCH1 WT -transfected cells. g mRNA expression levels of three isoforms of FBXW7 (relative to GAPDH) after transfection of NOTCH1 C1133Y or NOTCH1 WT in HN6 and CAL27 cells. <t>FBXW7β</t> mRNA was greatly reduced in NOTCH1 C1133Y transfected cells compared to FBXW7α or FBXW7γ mRNA levels. h Left panel, the band of FBXW7 were detected by western blot after transfection of three individual isoform plasmids. Right panel, the alteration of FBXW7β protein levels in NOTCH1 C1133Y overexpressed cells. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.
Sgrna Sequences Fbxw7β, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+sequences/pmc07426429-97-4-8?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
sgrna sequences fbxw7β - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
CustomArray Inc 20 nt target specific sgrna sequences
a , Schematic of <t>genome-scale</t> <t>CRISPRa</t> screening approach (see text for details). b , Overview of CRISPRa screen results. Negative τ values indicate depletion and positive values enrichment of cells following imatinib selection. Significant candidate genes (FDR<0.05, p<0.001) are in colour (blue = depleted, red = enriched). Validated candidate genes are labelled in black. Mann-Whitney U test was used to calculate p-values as described previously . To correct for multiple hypothesis testing, we first performed random sampling with replacement among the set of τ values for non-targeting control sgRNAs and calculated p-values for each sampling. Then, we calculated the false discover rate (FDR) based on the distribution of p-values for all genes in the library and for non-targeting controls generated above. c, Candidate gene validation. Enrichment of candidate <t>sgRNA</t> expressing cells was measured over time. Values represent the mean of three different sgRNAs targeting each gene with s.e.m. Grey shading = two standard deviations of sgNTCs at day 15. All values from separate sgRNAs on days 7, 11 and 15 normalised to baseline or untreated cells are shown in .
20 Nt Target Specific Sgrna Sequences, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+sequences/pmc06072461-138-7-20?v=CustomArray+Inc
Average 90 stars, based on 1 article reviews
20 nt target specific sgrna sequences - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation arid4b sgrna sequences
(A) Genotype distribution of progenies from the mating of <t>Arid4b</t> +/flox ; Vav-iCre female and Arid4b flox/flox male mice. Progenies were at E13.5, E14.5, E16.5, or the neonatal stage. (B) Images of the Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos and corresponding FLs at E13.5, E14.5, and E16.5. Scale bar, 3 mm. (C) Images of Arid4b HC+/− and Arid4b HC−/− embryos at E18.5. Scale bar, 3 mm. (D) Hematoxylin and eosin staining of FL sections from Arid4b HC +/+ and Arid4b HC−/− embryos at E13.5, E14.5, and E16.5. Scale bar, 20 μm. (E) Total viable cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5, E14.5, and E16.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01. Statistical analysis: t test.
Arid4b Sgrna Sequences, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+sequences/pmc08722094-96-0-5?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
arid4b sgrna sequences - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
CustomArray Inc sgrna sequences
(A) Genotype distribution of progenies from the mating of <t>Arid4b</t> +/flox ; Vav-iCre female and Arid4b flox/flox male mice. Progenies were at E13.5, E14.5, E16.5, or the neonatal stage. (B) Images of the Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos and corresponding FLs at E13.5, E14.5, and E16.5. Scale bar, 3 mm. (C) Images of Arid4b HC+/− and Arid4b HC−/− embryos at E18.5. Scale bar, 3 mm. (D) Hematoxylin and eosin staining of FL sections from Arid4b HC +/+ and Arid4b HC−/− embryos at E13.5, E14.5, and E16.5. Scale bar, 20 μm. (E) Total viable cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5, E14.5, and E16.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01. Statistical analysis: t test.
Sgrna Sequences, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+sequences/bio_rxiv__2022__08__02__502458-365-11-18?v=CustomArray+Inc
Average 90 stars, based on 1 article reviews
sgrna sequences - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation human parp2 isoform 2 (1-570) pet28a (plasmid
( A ) Top: schematic of ALC1 constructs used in EMSA experiments. The arginine anchor residue R611, previously shown to interact with the nucleosome acidic patch, is indicated. Bottom: EMSA analysis of the complexes formed by different constructs of ALC1 and a 5’P-10-N-10 nucleosome in absence or presence of PAR chains deposited by <t>PARP2</t> and HPF1. ( B ) Nucleosome sliding assay of 10 nM nucleosomes by 31.3 nM ALC1 fl , performed after PARylation by 80 nM of PARP1 with 25 µM NAD + in the absence (teal) and presence (orange) of 20 nM of HPF1. ( C ) Preparation and native PAGE analysis of the complex between ALC1 fl and a PARylated nucleosome for cryo-EM (see Materials and methods). Figure 1—source data 1. Tiff files of raw gel images for .
Human Parp2 Isoform 2 (1 570) Pet28a (Plasmid, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+sequences/pmc08463071-47-4-12?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
human parp2 isoform 2 (1-570) pet28a (plasmid - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Synbio Technologies LLC sgrna sequences
( A ) Top: schematic of ALC1 constructs used in EMSA experiments. The arginine anchor residue R611, previously shown to interact with the nucleosome acidic patch, is indicated. Bottom: EMSA analysis of the complexes formed by different constructs of ALC1 and a 5’P-10-N-10 nucleosome in absence or presence of PAR chains deposited by <t>PARP2</t> and HPF1. ( B ) Nucleosome sliding assay of 10 nM nucleosomes by 31.3 nM ALC1 fl , performed after PARylation by 80 nM of PARP1 with 25 µM NAD + in the absence (teal) and presence (orange) of 20 nM of HPF1. ( C ) Preparation and native PAGE analysis of the complex between ALC1 fl and a PARylated nucleosome for cryo-EM (see Materials and methods). Figure 1—source data 1. Tiff files of raw gel images for .
Sgrna Sequences, supplied by Synbio Technologies LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+sequences/pmc11363528-57-6-27?v=Synbio+Technologies+LLC
Average 90 stars, based on 1 article reviews
sgrna sequences - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
VectorBuilder GmbH sgrna targeting the psmg2 sequence ttccggtacctacttacacc (exon 5)
( A ) Top: schematic of ALC1 constructs used in EMSA experiments. The arginine anchor residue R611, previously shown to interact with the nucleosome acidic patch, is indicated. Bottom: EMSA analysis of the complexes formed by different constructs of ALC1 and a 5’P-10-N-10 nucleosome in absence or presence of PAR chains deposited by <t>PARP2</t> and HPF1. ( B ) Nucleosome sliding assay of 10 nM nucleosomes by 31.3 nM ALC1 fl , performed after PARylation by 80 nM of PARP1 with 25 µM NAD + in the absence (teal) and presence (orange) of 20 nM of HPF1. ( C ) Preparation and native PAGE analysis of the complex between ALC1 fl and a PARylated nucleosome for cryo-EM (see Materials and methods). Figure 1—source data 1. Tiff files of raw gel images for .
Sgrna Targeting The Psmg2 Sequence Ttccggtacctacttacacc (Exon 5), supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+sequences/pmc12035902-251-1-16?v=VectorBuilder+GmbH
Average 90 stars, based on 1 article reviews
sgrna targeting the psmg2 sequence ttccggtacctacttacacc (exon 5) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Synbio Technologies LLC sgrnas sequences
( A ) Top: schematic of ALC1 constructs used in EMSA experiments. The arginine anchor residue R611, previously shown to interact with the nucleosome acidic patch, is indicated. Bottom: EMSA analysis of the complexes formed by different constructs of ALC1 and a 5’P-10-N-10 nucleosome in absence or presence of PAR chains deposited by <t>PARP2</t> and HPF1. ( B ) Nucleosome sliding assay of 10 nM nucleosomes by 31.3 nM ALC1 fl , performed after PARylation by 80 nM of PARP1 with 25 µM NAD + in the absence (teal) and presence (orange) of 20 nM of HPF1. ( C ) Preparation and native PAGE analysis of the complex between ALC1 fl and a PARylated nucleosome for cryo-EM (see Materials and methods). Figure 1—source data 1. Tiff files of raw gel images for .
Sgrnas Sequences, supplied by Synbio Technologies LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+sequences/pmc10998809-40-4-39?v=Synbio+Technologies+LLC
Average 90 stars, based on 1 article reviews
sgrnas sequences - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the sgRNA scaffold. (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.

Journal: STAR Protocols

Article Title: Efficient CRISPR-Cas9-mediated genome editing for characterization of essential genes in Trypanosoma cruzi

doi: 10.1016/j.xpro.2022.101324

Figure Lengend Snippet: Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the sgRNA scaffold. (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.

Article Snippet: Note: In this work, the sgRNA scaffold sequence was acquired cloned into pUC19 from GenScript, but the sgRNA scaffold can be cloned in any other vector. a. Scaffold sequence: GAATTC CATGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT AAGCTT .

Techniques: Knock-Out, CRISPR, In Vitro

Journal: STAR Protocols

Article Title: Efficient CRISPR-Cas9-mediated genome editing for characterization of essential genes in Trypanosoma cruzi

doi: 10.1016/j.xpro.2022.101324

Figure Lengend Snippet:

Article Snippet: Note: In this work, the sgRNA scaffold sequence was acquired cloned into pUC19 from GenScript, but the sgRNA scaffold can be cloned in any other vector. a. Scaffold sequence: GAATTC CATGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT AAGCTT .

Techniques: Virus, Recombinant, Transfection, Plasmid Preparation, Staining, Expressing, Software, CRISPR, Cytometry

a Transfection efficiency of HN6 and CAL27 NOTCH1 C1133Y and WT cells determined by real-time qPCR. b Growth curves of NOTCH1 WT -transfected cells (blue lines), NOTCH1 C1133Y -transfected cells (red lines) and control cells (black lines). The NOTCH1 C1133Y -transfected cells had higher proliferation rates compared with the NOTCH1 WT -transfected cells. c Colony formation assays were performed for 2 week in six-well cell culture cluster in HN6 and CAL27 stable transfected cells. d NOTCH1 C1133Y - transfected cells presented a significantly lower percentage of G1 phase and higher ratio of S phase than NOTCH1 WT cells. e , f Wound healing and Transwell assays were employed to analyze the cell migration and invasion ability. NOTCH1 C1133Y -transfected cells exhibited higher metastatic ability in HN6 and CAL27 cell lines compared with NOTCH1 WT -transfected cells. g mRNA expression levels of three isoforms of FBXW7 (relative to GAPDH) after transfection of NOTCH1 C1133Y or NOTCH1 WT in HN6 and CAL27 cells. FBXW7β mRNA was greatly reduced in NOTCH1 C1133Y transfected cells compared to FBXW7α or FBXW7γ mRNA levels. h Left panel, the band of FBXW7 were detected by western blot after transfection of three individual isoform plasmids. Right panel, the alteration of FBXW7β protein levels in NOTCH1 C1133Y overexpressed cells. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a Transfection efficiency of HN6 and CAL27 NOTCH1 C1133Y and WT cells determined by real-time qPCR. b Growth curves of NOTCH1 WT -transfected cells (blue lines), NOTCH1 C1133Y -transfected cells (red lines) and control cells (black lines). The NOTCH1 C1133Y -transfected cells had higher proliferation rates compared with the NOTCH1 WT -transfected cells. c Colony formation assays were performed for 2 week in six-well cell culture cluster in HN6 and CAL27 stable transfected cells. d NOTCH1 C1133Y - transfected cells presented a significantly lower percentage of G1 phase and higher ratio of S phase than NOTCH1 WT cells. e , f Wound healing and Transwell assays were employed to analyze the cell migration and invasion ability. NOTCH1 C1133Y -transfected cells exhibited higher metastatic ability in HN6 and CAL27 cell lines compared with NOTCH1 WT -transfected cells. g mRNA expression levels of three isoforms of FBXW7 (relative to GAPDH) after transfection of NOTCH1 C1133Y or NOTCH1 WT in HN6 and CAL27 cells. FBXW7β mRNA was greatly reduced in NOTCH1 C1133Y transfected cells compared to FBXW7α or FBXW7γ mRNA levels. h Left panel, the band of FBXW7 were detected by western blot after transfection of three individual isoform plasmids. Right panel, the alteration of FBXW7β protein levels in NOTCH1 C1133Y overexpressed cells. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Transfection, Cell Culture, Migration, Expressing, Western Blot

a The subcellular location of NOTCH1 receptors in CAL27 cells was assessed by immunofluorescence. The NOTCH1-FITC staining revealed that NOTCH1 protein in C1133Y-mutated cells was only localized in the cytoplasm. Costaining of NOTCH1 with ER-marker Calnexin showed strong overlapped staining in NOTCH1 C1133Y -transfected cells. FBXW7β-EGFP staining was present in the microsomal fraction together with the ER-resident protein Calnexin. Scale bar, 20 μm. b The localization of NOTCH1 or FBXW7β in cytoplasm or nucleus was assessed in 100 cells, and the percent of cells was shown. The data indicated that 79.3% of NOTCH1 C1133Y -transfected cells and 85.3% of FBXW7β-transfected cells exhibited cytoplasmic expression, but that only 54% of NOTCH1 WT -transfected cells exhibited cell cytoplasmic expression. c Overlapped staining of NOTCH1 or FBXW7β with ER-marker Calnexin was counted in NOTCH1 C1133Y and NOTCH1 WT or FBXW7β transfected cells. In all, 82.8% of NOTCH1 C1133Y -transfected cells and 91.2% of FBXW7β-transfected cells showed overlap between FITC (NOTCH1 or FBXW7β staining) and CY3 (Calnexin staining), while 50.5% of NOTCH1 WT -transfected cells showed overlapped staining between NOTCH1 and Calnexin. Data are mean ± SD. Percentages of localization were calculated from three independent experiments. ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a The subcellular location of NOTCH1 receptors in CAL27 cells was assessed by immunofluorescence. The NOTCH1-FITC staining revealed that NOTCH1 protein in C1133Y-mutated cells was only localized in the cytoplasm. Costaining of NOTCH1 with ER-marker Calnexin showed strong overlapped staining in NOTCH1 C1133Y -transfected cells. FBXW7β-EGFP staining was present in the microsomal fraction together with the ER-resident protein Calnexin. Scale bar, 20 μm. b The localization of NOTCH1 or FBXW7β in cytoplasm or nucleus was assessed in 100 cells, and the percent of cells was shown. The data indicated that 79.3% of NOTCH1 C1133Y -transfected cells and 85.3% of FBXW7β-transfected cells exhibited cytoplasmic expression, but that only 54% of NOTCH1 WT -transfected cells exhibited cell cytoplasmic expression. c Overlapped staining of NOTCH1 or FBXW7β with ER-marker Calnexin was counted in NOTCH1 C1133Y and NOTCH1 WT or FBXW7β transfected cells. In all, 82.8% of NOTCH1 C1133Y -transfected cells and 91.2% of FBXW7β-transfected cells showed overlap between FITC (NOTCH1 or FBXW7β staining) and CY3 (Calnexin staining), while 50.5% of NOTCH1 WT -transfected cells showed overlapped staining between NOTCH1 and Calnexin. Data are mean ± SD. Percentages of localization were calculated from three independent experiments. ** p < 0.01, *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Immunofluorescence, Staining, Marker, Transfection, Expressing

a Fold change of FBXW7β mRNA levels in 30 paired OSCC tissues. b Fold change of FBXW7β protein expression levels in eight OSCC tissues and two nontumor tissues. c Relative FBXW7β mRNA and protein levels in five OSCC cell lines and one normal oral epithelial cell line (HOK). d qRT-PCR detection after transfection of PEGFP-N1-FBXW7α or PEGFP-N1-FBXW7β or PEGFP-N1-FBXW7γ and empty vector in HN6 and CAL27 cells. e – g Wound healing ( e ), Transwell ( f ), and CCK-8 ( g ) assays were employed to analyze the cell migration, invasion, and proliferation ability. Compared with other two subtypes, overexpression of FBXW7β significantly reduced cell growth, migration, and invasion. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a Fold change of FBXW7β mRNA levels in 30 paired OSCC tissues. b Fold change of FBXW7β protein expression levels in eight OSCC tissues and two nontumor tissues. c Relative FBXW7β mRNA and protein levels in five OSCC cell lines and one normal oral epithelial cell line (HOK). d qRT-PCR detection after transfection of PEGFP-N1-FBXW7α or PEGFP-N1-FBXW7β or PEGFP-N1-FBXW7γ and empty vector in HN6 and CAL27 cells. e – g Wound healing ( e ), Transwell ( f ), and CCK-8 ( g ) assays were employed to analyze the cell migration, invasion, and proliferation ability. Compared with other two subtypes, overexpression of FBXW7β significantly reduced cell growth, migration, and invasion. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Expressing, Quantitative RT-PCR, Transfection, Plasmid Preparation, CCK-8 Assay, Migration, Over Expression

a Flow cytometry analysis showed cell cycle arrest due to FBXW7β transfection (left panel). Proteins related to cell cycle progression were demonstrated (middle and right panel). FBXW7β overexpression resulted in the decreased expression levels of cell cycle related proteins. b FBXW7β-sgRNA dramatically increased the number of colonies (left panel) and cell growth (right panel). c , d Depleting FBXW7β potently promoted cell migration ( c ) and invasion ( d ). Data are mean ± SD from three independent experiments. e The tumors dissected from mice ( n = 6 for each group) were presented. f – h Evaluation on tumor incidence ( f ), weight ( g ), and size ( h ). All the results were shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a Flow cytometry analysis showed cell cycle arrest due to FBXW7β transfection (left panel). Proteins related to cell cycle progression were demonstrated (middle and right panel). FBXW7β overexpression resulted in the decreased expression levels of cell cycle related proteins. b FBXW7β-sgRNA dramatically increased the number of colonies (left panel) and cell growth (right panel). c , d Depleting FBXW7β potently promoted cell migration ( c ) and invasion ( d ). Data are mean ± SD from three independent experiments. e The tumors dissected from mice ( n = 6 for each group) were presented. f – h Evaluation on tumor incidence ( f ), weight ( g ), and size ( h ). All the results were shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Flow Cytometry, Transfection, Over Expression, Expressing, Migration

a , b Western blotting was used to detect the expression levels of NOTCH1 and FBXW7β. The overexpression of NOTCH1 C1133Y decreased FBXW7β expression, whereas the upregulation of FBXW7β attenuated the loss of FBXW7β expression in NOTCH1 C1133Y overexpressed HN6 and CAL27 cells. c CCK-8 assay showed that upregulation of NOTCH1 C1133Y dramatically increased the cell proliferation ability in HN6 and CAL27 cells. d Transwell assay showed that the upregulation of FBXW7β significantly reduced the cell invasion in NOTCH1 C1133Y transfected cells. Data are mean ± SD from three independent experiments. e The tumors dissected from mice were presented ( n = 6 for each group). From top to bottom, each line of tumors represented: FBXW7β, NOTCH1 C1133Y , FBXW7β+ NOTCH1 C1133Y , and NC. f – h Evaluation on tumor incidence, weight, and size. All the results were shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a , b Western blotting was used to detect the expression levels of NOTCH1 and FBXW7β. The overexpression of NOTCH1 C1133Y decreased FBXW7β expression, whereas the upregulation of FBXW7β attenuated the loss of FBXW7β expression in NOTCH1 C1133Y overexpressed HN6 and CAL27 cells. c CCK-8 assay showed that upregulation of NOTCH1 C1133Y dramatically increased the cell proliferation ability in HN6 and CAL27 cells. d Transwell assay showed that the upregulation of FBXW7β significantly reduced the cell invasion in NOTCH1 C1133Y transfected cells. Data are mean ± SD from three independent experiments. e The tumors dissected from mice were presented ( n = 6 for each group). From top to bottom, each line of tumors represented: FBXW7β, NOTCH1 C1133Y , FBXW7β+ NOTCH1 C1133Y , and NC. f – h Evaluation on tumor incidence, weight, and size. All the results were shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Western Blot, Expressing, Over Expression, CCK-8 Assay, Transwell Assay, Transfection

a , b AKT/ERK/NFκB signaling activities were evaluated by western blot analysis in HN6 ( a ) and CAL27 cells ( b ). The gray values of images demonstrated that FBXW7β transfection decreased phosphorylation of AKT/ERK/NFκB and reversed the NOTCH1 C1133Y -induced activation of AKT/ERK/NFκB phosphorylation. c , d Overexpression of FBXW7β reversed the increased protein expression levels of EMT markers and prevented the decrease in E-cadherin and β-Catenin caused by NOTCH1 C1133Y in HN6 ( c ) and CAL27 ( d ) cells. e The expression of p-AKT, p-ERK, and p-NFκB in xenografted mice was ascertained using IHC assay on tumor sections. The percentages of positive cells were acquired from three separate images and the qualification was presented. Scale bar, 20 μm. All the results were shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a , b AKT/ERK/NFκB signaling activities were evaluated by western blot analysis in HN6 ( a ) and CAL27 cells ( b ). The gray values of images demonstrated that FBXW7β transfection decreased phosphorylation of AKT/ERK/NFκB and reversed the NOTCH1 C1133Y -induced activation of AKT/ERK/NFκB phosphorylation. c , d Overexpression of FBXW7β reversed the increased protein expression levels of EMT markers and prevented the decrease in E-cadherin and β-Catenin caused by NOTCH1 C1133Y in HN6 ( c ) and CAL27 ( d ) cells. e The expression of p-AKT, p-ERK, and p-NFκB in xenografted mice was ascertained using IHC assay on tumor sections. The percentages of positive cells were acquired from three separate images and the qualification was presented. Scale bar, 20 μm. All the results were shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Western Blot, Transfection, Activation Assay, Over Expression, Expressing

a HN6 and CAL27 NOTCH1 C1133Y -transfected cells were treated with MG132 (10 μM) for the indicated times, and then the levels of NOTCH1 were detected. b The cells were subjected to cycloheximide (CHX) (20 μM) exposure at the indicated times, and the protein expression levels of NOTCH1 were verified. c Co-IP between NOTCH1 C1133Y and ubiquitin in HN6 and CAL27 cells. d Co-IP experiment showed that NOTCH1 C1133Y could be co-precipitated together with FBXW7β. HN6 or CAL27 cells were transfected with NOTCH1 C1133Y , NOTCH1 WT , or NC plasmids and precipitated with NOTCH1 antibody. IgG group presented the lysates of cells transfected with NOTCH1 C1133Y were precipitated with igG, which represented the negative control. e Detection of the effects of NOTCH1 C1133Y on FBXW7β expression, either with or without CHX (20 μM) in HN6 and CAL27 cells. f Ectopic dose-dependent effect of NOTCH1 C1133Y overexpression caused a significant reduction of endogenous FBXW7β proteins. g Co-IP experiment showed MG-132 promoted the binding level of NOTCH1 and FBXW7β. The cells in NOTCH1 C1133Y groups were treated with or without proteasomal inhibitor MG132 (10 μM). Cell lysates were prepared and subjected to immunoprecipitation with anti-GFP antibody. The level of FBXW7β was detected by western blotting analysis. Data are mean ± SD from three independent experiments. *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a HN6 and CAL27 NOTCH1 C1133Y -transfected cells were treated with MG132 (10 μM) for the indicated times, and then the levels of NOTCH1 were detected. b The cells were subjected to cycloheximide (CHX) (20 μM) exposure at the indicated times, and the protein expression levels of NOTCH1 were verified. c Co-IP between NOTCH1 C1133Y and ubiquitin in HN6 and CAL27 cells. d Co-IP experiment showed that NOTCH1 C1133Y could be co-precipitated together with FBXW7β. HN6 or CAL27 cells were transfected with NOTCH1 C1133Y , NOTCH1 WT , or NC plasmids and precipitated with NOTCH1 antibody. IgG group presented the lysates of cells transfected with NOTCH1 C1133Y were precipitated with igG, which represented the negative control. e Detection of the effects of NOTCH1 C1133Y on FBXW7β expression, either with or without CHX (20 μM) in HN6 and CAL27 cells. f Ectopic dose-dependent effect of NOTCH1 C1133Y overexpression caused a significant reduction of endogenous FBXW7β proteins. g Co-IP experiment showed MG-132 promoted the binding level of NOTCH1 and FBXW7β. The cells in NOTCH1 C1133Y groups were treated with or without proteasomal inhibitor MG132 (10 μM). Cell lysates were prepared and subjected to immunoprecipitation with anti-GFP antibody. The level of FBXW7β was detected by western blotting analysis. Data are mean ± SD from three independent experiments. *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Transfection, Expressing, Co-Immunoprecipitation Assay, Negative Control, Over Expression, Binding Assay, Immunoprecipitation, Western Blot

a , Schematic of genome-scale CRISPRa screening approach (see text for details). b , Overview of CRISPRa screen results. Negative τ values indicate depletion and positive values enrichment of cells following imatinib selection. Significant candidate genes (FDR<0.05, p<0.001) are in colour (blue = depleted, red = enriched). Validated candidate genes are labelled in black. Mann-Whitney U test was used to calculate p-values as described previously . To correct for multiple hypothesis testing, we first performed random sampling with replacement among the set of τ values for non-targeting control sgRNAs and calculated p-values for each sampling. Then, we calculated the false discover rate (FDR) based on the distribution of p-values for all genes in the library and for non-targeting controls generated above. c, Candidate gene validation. Enrichment of candidate sgRNA expressing cells was measured over time. Values represent the mean of three different sgRNAs targeting each gene with s.e.m. Grey shading = two standard deviations of sgNTCs at day 15. All values from separate sgRNAs on days 7, 11 and 15 normalised to baseline or untreated cells are shown in .

Journal: Nature biotechnology

Article Title: Dual gene activation and knockout screen reveals directional dependencies in genetic networks

doi: 10.1038/nbt.4062

Figure Lengend Snippet: a , Schematic of genome-scale CRISPRa screening approach (see text for details). b , Overview of CRISPRa screen results. Negative τ values indicate depletion and positive values enrichment of cells following imatinib selection. Significant candidate genes (FDR<0.05, p<0.001) are in colour (blue = depleted, red = enriched). Validated candidate genes are labelled in black. Mann-Whitney U test was used to calculate p-values as described previously . To correct for multiple hypothesis testing, we first performed random sampling with replacement among the set of τ values for non-targeting control sgRNAs and calculated p-values for each sampling. Then, we calculated the false discover rate (FDR) based on the distribution of p-values for all genes in the library and for non-targeting controls generated above. c, Candidate gene validation. Enrichment of candidate sgRNA expressing cells was measured over time. Values represent the mean of three different sgRNAs targeting each gene with s.e.m. Grey shading = two standard deviations of sgNTCs at day 15. All values from separate sgRNAs on days 7, 11 and 15 normalised to baseline or untreated cells are shown in .

Article Snippet: For the CRISPRa library, the designed 20 nt target specific sgRNA sequences were synthesised as a pool, on microarray surfaces (CustomArray, Inc.), flanked by overhangs compatible with Gibson Assembly into the pSico based sgLenti sgRNA library vector (see for vector map).

Techniques: Selection, MANN-WHITNEY, Sampling, Generated, Expressing

a, Concept of the application of the orthogonal system for directional gene interaction studies. In the same cell, one gene is activated (CRISPRa) while another gene in knocked out (SaCas9 nuclease). b–d, Correlation of τ values from two clonal cell line replicates is shown for b, gene activation, c, gene knockout and d, all possible combinations thereof. Correlation values (r) are Pearson product-moment correlation coefficients. e , Schematic of perturbation data set from each gene pair (blue = depleted, red = enriched, NTC = non-target control sgRNA) f, Formula for calculating Ψ scores. Negative Ψ scores define interactions in which directionality could be inferred. g , To determine which of both interaction partners acts up- or downstream, τ activation values were multiplied with genetic interaction scores. Positive values indicate a downstream function, negative values an upstream function of the activated gene. h , Based on GI and Ψ scores determined by the full orthogonal interaction screen, a genetic interaction model was constructed. For positive regulators of cell fitness, nodes are shown in red and negative regulators in blue. Arrow-shaped edges indicate inferred directional interactions between nodes. Line-shaped edges symbolise genetic interactions where directionality could not be inferred. Node sizes are proportional to the degree of connectivity. In total, 2258 gene:gene combinations that passed the filter criteria were considered for the construction of the directional genetic interaction network.

Journal: Nature biotechnology

Article Title: Dual gene activation and knockout screen reveals directional dependencies in genetic networks

doi: 10.1038/nbt.4062

Figure Lengend Snippet: a, Concept of the application of the orthogonal system for directional gene interaction studies. In the same cell, one gene is activated (CRISPRa) while another gene in knocked out (SaCas9 nuclease). b–d, Correlation of τ values from two clonal cell line replicates is shown for b, gene activation, c, gene knockout and d, all possible combinations thereof. Correlation values (r) are Pearson product-moment correlation coefficients. e , Schematic of perturbation data set from each gene pair (blue = depleted, red = enriched, NTC = non-target control sgRNA) f, Formula for calculating Ψ scores. Negative Ψ scores define interactions in which directionality could be inferred. g , To determine which of both interaction partners acts up- or downstream, τ activation values were multiplied with genetic interaction scores. Positive values indicate a downstream function, negative values an upstream function of the activated gene. h , Based on GI and Ψ scores determined by the full orthogonal interaction screen, a genetic interaction model was constructed. For positive regulators of cell fitness, nodes are shown in red and negative regulators in blue. Arrow-shaped edges indicate inferred directional interactions between nodes. Line-shaped edges symbolise genetic interactions where directionality could not be inferred. Node sizes are proportional to the degree of connectivity. In total, 2258 gene:gene combinations that passed the filter criteria were considered for the construction of the directional genetic interaction network.

Article Snippet: For the CRISPRa library, the designed 20 nt target specific sgRNA sequences were synthesised as a pool, on microarray surfaces (CustomArray, Inc.), flanked by overhangs compatible with Gibson Assembly into the pSico based sgLenti sgRNA library vector (see for vector map).

Techniques: Activation Assay, Gene Knockout, Construct

(A) Genotype distribution of progenies from the mating of Arid4b +/flox ; Vav-iCre female and Arid4b flox/flox male mice. Progenies were at E13.5, E14.5, E16.5, or the neonatal stage. (B) Images of the Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos and corresponding FLs at E13.5, E14.5, and E16.5. Scale bar, 3 mm. (C) Images of Arid4b HC+/− and Arid4b HC−/− embryos at E18.5. Scale bar, 3 mm. (D) Hematoxylin and eosin staining of FL sections from Arid4b HC +/+ and Arid4b HC−/− embryos at E13.5, E14.5, and E16.5. Scale bar, 20 μm. (E) Total viable cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5, E14.5, and E16.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01. Statistical analysis: t test.

Journal: Cell reports

Article Title: Differentiation of fetal hematopoietic stem cells requires ARID4B to restrict autocrine KITLG/KIT-Src signaling

doi: 10.1016/j.celrep.2021.110036

Figure Lengend Snippet: (A) Genotype distribution of progenies from the mating of Arid4b +/flox ; Vav-iCre female and Arid4b flox/flox male mice. Progenies were at E13.5, E14.5, E16.5, or the neonatal stage. (B) Images of the Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos and corresponding FLs at E13.5, E14.5, and E16.5. Scale bar, 3 mm. (C) Images of Arid4b HC+/− and Arid4b HC−/− embryos at E18.5. Scale bar, 3 mm. (D) Hematoxylin and eosin staining of FL sections from Arid4b HC +/+ and Arid4b HC−/− embryos at E13.5, E14.5, and E16.5. Scale bar, 20 μm. (E) Total viable cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5, E14.5, and E16.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01. Statistical analysis: t test.

Article Snippet: ARID4B sgRNA sequences: AGTTCAGGATGACCACATAA , GenScript , Cat# U0898BC010_2.

Techniques: Staining

(A–J) The numbers of Ter119 + erythroid (A), Gr-1 + myeloid (B), B220 + lymphoid (C), Lin − (D), LS − K (E), LSK (F), LT-HSC (G), ST-HSC (H), MPP2 (I), and MPP3/4 (J) cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5 and/or E14.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01, ***p < 0.001. Statistical analysis: t test. (K) Scheme of competitive transplantation assay. KIT + cells from E13.5 Arid4b HC+/+ , Arid4b HC+/− , or Arid4b HC−/− FLs (CD45.2 + ) mixed with competitive bone marrow (BM) cells from adult wild-type mice (CD45.1 + ) were injected via tail vein into lethally irradiated recipient mice (CD45.1 + ). 1, 2, and 4 months after transplantation, CD45.1 + and CD45.2 + cells in peripheral blood cells from the recipient mice were analyzed by flow cytometry. (L) Flow cytometry plots showing the percentages of CD45.1 + and CD45.2 + cells in peripheral blood of recipient mice (CD45.1 + ) 1 month after transplantation with KIT + cells (CD45.2 + ) from E13.5 FLs of the indicated genotypes and bone marrow cells (CD45.1 + ) from wild-type mice. (M) Percentages of CD45.2 + cells in peripheral blood of recipient mice 1, 2, and 4 months after competitive transplantation. NS, not significant.

Journal: Cell reports

Article Title: Differentiation of fetal hematopoietic stem cells requires ARID4B to restrict autocrine KITLG/KIT-Src signaling

doi: 10.1016/j.celrep.2021.110036

Figure Lengend Snippet: (A–J) The numbers of Ter119 + erythroid (A), Gr-1 + myeloid (B), B220 + lymphoid (C), Lin − (D), LS − K (E), LSK (F), LT-HSC (G), ST-HSC (H), MPP2 (I), and MPP3/4 (J) cells in Arid4b HC +/+ , Arid4b HC +/− , and Arid4b HC−/− FLs at E13.5 and/or E14.5. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01, ***p < 0.001. Statistical analysis: t test. (K) Scheme of competitive transplantation assay. KIT + cells from E13.5 Arid4b HC+/+ , Arid4b HC+/− , or Arid4b HC−/− FLs (CD45.2 + ) mixed with competitive bone marrow (BM) cells from adult wild-type mice (CD45.1 + ) were injected via tail vein into lethally irradiated recipient mice (CD45.1 + ). 1, 2, and 4 months after transplantation, CD45.1 + and CD45.2 + cells in peripheral blood cells from the recipient mice were analyzed by flow cytometry. (L) Flow cytometry plots showing the percentages of CD45.1 + and CD45.2 + cells in peripheral blood of recipient mice (CD45.1 + ) 1 month after transplantation with KIT + cells (CD45.2 + ) from E13.5 FLs of the indicated genotypes and bone marrow cells (CD45.1 + ) from wild-type mice. (M) Percentages of CD45.2 + cells in peripheral blood of recipient mice 1, 2, and 4 months after competitive transplantation. NS, not significant.

Article Snippet: ARID4B sgRNA sequences: AGTTCAGGATGACCACATAA , GenScript , Cat# U0898BC010_2.

Techniques: Transplantation Assay, Injection, Irradiation, Flow Cytometry

(A–C) Immunofluorescence staining followed by flow cytometry analyses of KITLG (A), KIT (B), and ARID4B (C) in KIT + cells from E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs. (D) Immunohistochemistry staining of KITLG in FL sections of E13.5 Arid4b HC +/+ and Arid4b HC−/− embryos. Scale bar, 50 μm. (E) Western blot analysis showing KITLG, KIT, phospho-Src, and Src in E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs. (F–J) Immunofluorescence staining followed by flow cytometry analyses of KITLG in LT-HSC (F), ST-HSC (G), MPP2 (H), and MPP3/4 (I) cells from E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs and quantifications (J). Data are means ± SEM (n = 3). *p < 0.05; ***p < 0.001. Statistical analysis: t test.

Journal: Cell reports

Article Title: Differentiation of fetal hematopoietic stem cells requires ARID4B to restrict autocrine KITLG/KIT-Src signaling

doi: 10.1016/j.celrep.2021.110036

Figure Lengend Snippet: (A–C) Immunofluorescence staining followed by flow cytometry analyses of KITLG (A), KIT (B), and ARID4B (C) in KIT + cells from E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs. (D) Immunohistochemistry staining of KITLG in FL sections of E13.5 Arid4b HC +/+ and Arid4b HC−/− embryos. Scale bar, 50 μm. (E) Western blot analysis showing KITLG, KIT, phospho-Src, and Src in E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs. (F–J) Immunofluorescence staining followed by flow cytometry analyses of KITLG in LT-HSC (F), ST-HSC (G), MPP2 (H), and MPP3/4 (I) cells from E14.5 Arid4b HC +/+ and Arid4b HC−/− FLs and quantifications (J). Data are means ± SEM (n = 3). *p < 0.05; ***p < 0.001. Statistical analysis: t test.

Article Snippet: ARID4B sgRNA sequences: AGTTCAGGATGACCACATAA , GenScript , Cat# U0898BC010_2.

Techniques: Immunofluorescence, Staining, Flow Cytometry, Immunohistochemistry, Western Blot

(A) Images of E14.5 Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos with PP2 treatment and corresponding FLs. Scale bar, 3 mm. (B–L) The cell numbers of LT-HSC (B), ST-HSC (C), MPP2 (D), MPP3/4 (E), LSK (F), LS − K (G), Lin − (H), total viable cells (I), Ter119 + erythroid (J), Gr-1 + myeloid (K), and B220 + lymphoid (L) populations in E14.5 Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− FLs with PP2 treatment. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01, ***p < 0.001. Statistical analysis: t test. (M–O) Quantifications of hematopoietic colony-forming assays using total cells of E14.5 Arid4b HC +/+ and Arid4b HC −/− FLs with or without PP2 for colony formation of CFU-GEMM (M), CFU-GM (N), and BFU-E (O). Data are means ± SEM (n = 3). *p < 0.05, ***p < 0.001. Statistical analysis: t test. (P–R) Hierarchy of HSCs and MPPs showing that the HSPC pool contains LT-HSCs, ST-HSCs, MPP2 cells, MPP3 cells, and MPP4 cells. Self-renewable LT-HSCs give rise to ST-HSCs that have little self-renewal ability. ARID4B is critical for differentiation of HSCs into MPP2, MPP3, and MPP4 cells (P). Arid4b KO suppresses HSC differentiation to MPPs, resulting in ST-HSC accumulation (Q). PP2 treatment rescues the HSC differentiation defect elicited by Arid4b KO (R).

Journal: Cell reports

Article Title: Differentiation of fetal hematopoietic stem cells requires ARID4B to restrict autocrine KITLG/KIT-Src signaling

doi: 10.1016/j.celrep.2021.110036

Figure Lengend Snippet: (A) Images of E14.5 Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− embryos with PP2 treatment and corresponding FLs. Scale bar, 3 mm. (B–L) The cell numbers of LT-HSC (B), ST-HSC (C), MPP2 (D), MPP3/4 (E), LSK (F), LS − K (G), Lin − (H), total viable cells (I), Ter119 + erythroid (J), Gr-1 + myeloid (K), and B220 + lymphoid (L) populations in E14.5 Arid4b HC +/+ , Arid4b HC+/− , and Arid4b HC−/− FLs with PP2 treatment. Data are means ± SEM (n ≥ 3). *p < 0.05, **p < 0.01, ***p < 0.001. Statistical analysis: t test. (M–O) Quantifications of hematopoietic colony-forming assays using total cells of E14.5 Arid4b HC +/+ and Arid4b HC −/− FLs with or without PP2 for colony formation of CFU-GEMM (M), CFU-GM (N), and BFU-E (O). Data are means ± SEM (n = 3). *p < 0.05, ***p < 0.001. Statistical analysis: t test. (P–R) Hierarchy of HSCs and MPPs showing that the HSPC pool contains LT-HSCs, ST-HSCs, MPP2 cells, MPP3 cells, and MPP4 cells. Self-renewable LT-HSCs give rise to ST-HSCs that have little self-renewal ability. ARID4B is critical for differentiation of HSCs into MPP2, MPP3, and MPP4 cells (P). Arid4b KO suppresses HSC differentiation to MPPs, resulting in ST-HSC accumulation (Q). PP2 treatment rescues the HSC differentiation defect elicited by Arid4b KO (R).

Article Snippet: ARID4B sgRNA sequences: AGTTCAGGATGACCACATAA , GenScript , Cat# U0898BC010_2.

Techniques:

Journal: Cell reports

Article Title: Differentiation of fetal hematopoietic stem cells requires ARID4B to restrict autocrine KITLG/KIT-Src signaling

doi: 10.1016/j.celrep.2021.110036

Figure Lengend Snippet:

Article Snippet: ARID4B sgRNA sequences: AGTTCAGGATGACCACATAA , GenScript , Cat# U0898BC010_2.

Techniques: Blocking Assay, Recombinant, Electron Microscopy, Plasmid Preparation, Red Blood Cell Lysis, Protease Inhibitor, SYBR Green Assay, Transfection, Gene Expression, Software, Microscopy, Irradiation, Flow Cytometry

( A ) Top: schematic of ALC1 constructs used in EMSA experiments. The arginine anchor residue R611, previously shown to interact with the nucleosome acidic patch, is indicated. Bottom: EMSA analysis of the complexes formed by different constructs of ALC1 and a 5’P-10-N-10 nucleosome in absence or presence of PAR chains deposited by PARP2 and HPF1. ( B ) Nucleosome sliding assay of 10 nM nucleosomes by 31.3 nM ALC1 fl , performed after PARylation by 80 nM of PARP1 with 25 µM NAD + in the absence (teal) and presence (orange) of 20 nM of HPF1. ( C ) Preparation and native PAGE analysis of the complex between ALC1 fl and a PARylated nucleosome for cryo-EM (see Materials and methods). Figure 1—source data 1. Tiff files of raw gel images for .

Journal: eLife

Article Title: Structure and dynamics of the chromatin remodeler ALC1 bound to a PARylated nucleosome

doi: 10.7554/eLife.71420

Figure Lengend Snippet: ( A ) Top: schematic of ALC1 constructs used in EMSA experiments. The arginine anchor residue R611, previously shown to interact with the nucleosome acidic patch, is indicated. Bottom: EMSA analysis of the complexes formed by different constructs of ALC1 and a 5’P-10-N-10 nucleosome in absence or presence of PAR chains deposited by PARP2 and HPF1. ( B ) Nucleosome sliding assay of 10 nM nucleosomes by 31.3 nM ALC1 fl , performed after PARylation by 80 nM of PARP1 with 25 µM NAD + in the absence (teal) and presence (orange) of 20 nM of HPF1. ( C ) Preparation and native PAGE analysis of the complex between ALC1 fl and a PARylated nucleosome for cryo-EM (see Materials and methods). Figure 1—source data 1. Tiff files of raw gel images for .

Article Snippet: Recombinant DNA reagent , Human PARP2 Isoform 2 (1-570) pET28a (plasmid) , GenScript , , UniProt ID Q9UGN5.

Techniques: Construct, Residue, Clear Native PAGE, Cryo-EM Sample Prep

SDS–PAGE and Western blot analysis of different PARylation conditions of nucleosomes by PARP1/HPF1 or PARP2/HPF1.

Journal: eLife

Article Title: Structure and dynamics of the chromatin remodeler ALC1 bound to a PARylated nucleosome

doi: 10.7554/eLife.71420

Figure Lengend Snippet: SDS–PAGE and Western blot analysis of different PARylation conditions of nucleosomes by PARP1/HPF1 or PARP2/HPF1.

Article Snippet: Recombinant DNA reagent , Human PARP2 Isoform 2 (1-570) pET28a (plasmid) , GenScript , , UniProt ID Q9UGN5.

Techniques: SDS Page, Western Blot

Screening micrographs of complexes prepared with ALC1 and nucleosomes either unmodified (left), PARylated by PARP1 and HPF1 (middle), or PARylated by PARP2 and HPF1 (right).

Journal: eLife

Article Title: Structure and dynamics of the chromatin remodeler ALC1 bound to a PARylated nucleosome

doi: 10.7554/eLife.71420

Figure Lengend Snippet: Screening micrographs of complexes prepared with ALC1 and nucleosomes either unmodified (left), PARylated by PARP1 and HPF1 (middle), or PARylated by PARP2 and HPF1 (right).

Article Snippet: Recombinant DNA reagent , Human PARP2 Isoform 2 (1-570) pET28a (plasmid) , GenScript , , UniProt ID Q9UGN5.

Techniques:

Upon DNA damage, PARP1 or PARP2 and HPF1 deposit PAR chains on histones, causing the rapid recruitment of proteins containing PAR reader domains. Among these proteins, ALC1 selectively binds to PAR chains with its macro domain and recognizes the closest nucleosome by probing its acidic patch. Once the macro domain and linker region of ALC1 jointly recognize a PARylated nucleosome, the ATPase motor is released from their auto-inhibitory effect and can tightly bind to the nucleosomal DNA at SHL2 for productive remodeling. Preferential PARylation of target sites spatially closest to the DNA break causes preferential recruitment of ALC1 on the side of the nucleosome such that remodeling slides this nucleosome away from the break. By setting directionality in remodeling, this mechanism could promote exposure of the lesion to downstream repair factors.

Journal: eLife

Article Title: Structure and dynamics of the chromatin remodeler ALC1 bound to a PARylated nucleosome

doi: 10.7554/eLife.71420

Figure Lengend Snippet: Upon DNA damage, PARP1 or PARP2 and HPF1 deposit PAR chains on histones, causing the rapid recruitment of proteins containing PAR reader domains. Among these proteins, ALC1 selectively binds to PAR chains with its macro domain and recognizes the closest nucleosome by probing its acidic patch. Once the macro domain and linker region of ALC1 jointly recognize a PARylated nucleosome, the ATPase motor is released from their auto-inhibitory effect and can tightly bind to the nucleosomal DNA at SHL2 for productive remodeling. Preferential PARylation of target sites spatially closest to the DNA break causes preferential recruitment of ALC1 on the side of the nucleosome such that remodeling slides this nucleosome away from the break. By setting directionality in remodeling, this mechanism could promote exposure of the lesion to downstream repair factors.

Article Snippet: Recombinant DNA reagent , Human PARP2 Isoform 2 (1-570) pET28a (plasmid) , GenScript , , UniProt ID Q9UGN5.

Techniques:

Journal: eLife

Article Title: Structure and dynamics of the chromatin remodeler ALC1 bound to a PARylated nucleosome

doi: 10.7554/eLife.71420

Figure Lengend Snippet:

Article Snippet: Recombinant DNA reagent , Human PARP2 Isoform 2 (1-570) pET28a (plasmid) , GenScript , , UniProt ID Q9UGN5.

Techniques: Polymer, Recombinant, Plasmid Preparation, Software